
CellBarcode is an R package for dealing with Cellular DNA barcoding sequencing data.
The R package was created by Wenjie SUN, Anne-Marie Lyne, and Leïla Perié at Institut Curie.
CellBarcode can handle all types of DNA barcodes, provided that:
Perform quality control for the DNA sequence results, and filter the sequences according to their quality metrics.
Identify barcode (and UMI) information in sequencing results.
Performs quality control and deal with the spurious sequences that come from potential PCR & sequence errors.
Provide toolkits to make it easier to manage samples and barcodes with metadata.
if(!requireNamespace("remotes", quietly = TRUE))
install.packages("remotes")
remotes::install_github("wenjie1991/CellBarcode")Here is an example of a basic workflow:
library(CellBarcode)
library(magrittr)
# The example data is a mix of MEF lines with known barcodes
# 2000 reads for each file have been sampled for this test dataset
# Data can be accessed here: https://zenodo.org/records/10027002
example_data <- system.file("extdata", "mef_test_data", package = "CellBarcode")
fq_files <- dir(example_data, "gz", full=TRUE)
# prepare metadata
metadata <- stringr::str_split_fixed(basename(fq_files), "_", 10)[, c(4, 6)]
metadata <- data.frame(metadata)
sample_name <- apply(metadata, 1, paste, collapse = "_")
colnames(metadata) = c("cell_number", "replication")
rownames(metadata) = sample_name
metadata
# extract UMI barcode with regular expression
bc_obj <- bc_extract(
fq_files,
pattern = "(.{12})CTCGAGGTCATCGAAGTATCAAG(.+)TAGCAAGCTCGAGAGTAGACCTACT",
pattern_type = c("UMI" = 1, "barcode" = 2),
sample_name = sample_name,
metadata = metadata
)
bc_obj
# sample subset operation, select 'mixa'
bc_sub <- bc_subset(bc_obj, sample=replication == "mixa")
bc_sub
# filter the barcode, UMI barcode amplicon >= 2 & UMI counts >= 2
bc_sub <- bc_cure_umi(bc_sub, depth = 2) %>% bc_cure_depth(depth = 2)
# select barcodes with a white list
bc_sub[c("AAGTCCAGTACTATCGTACTA", "AAGTCCAGTACTGTAGCTACTA"), ]
# export the barcode counts to data.frame
head(bc_2df(bc_sub))
# export the barcode counts to matrix
head(bc_2matrix(bc_sub))If you use CellBarcode in your research, please cite the following paper: Sun, W. et al. Extracting, filtering and simulating cellular barcodes using CellBarcode tools. Nat Comput Sci 1–16 (2024)